defmodule Bio.IO.Fasta do
@moduledoc """
Allow the input/output of FASTA formatted files.
The FASTA file format is composed of pairs of lines where the pair is
demarcated by the ">" character. All data proceeding the ">" character
represents the 'header' of the pair, while the next line after a newline
represents sequence data.
Any data after subsequent newlines that are _not_ preceded by a second ">"
character are assumed to be multi-line data. For example, the following two
files would be considered equivalent data:
```
# fasta 1
>header1
atgcatgca
```
and
```
# fasta 2
>header1
atgc
atgca
```
The FASTA file format does not specify the type of the data in the sequence.
That means that you can reasonably store RNA, DNA, amino acid, or any other
sequence using the format. The expectation is that the data is ASCII encoded.
The methods in this module do support reading into specified types. See
`read/2` for more details.
"""
@type header :: String.t()
@type sequence :: String.t()
@type read_opts ::
{:type, any()}
| {:parse_header, (String.t() -> String.t())}
@type fasta_data ::
[String.t()]
| [struct()]
| [{header(), sequence()}]
| %{headers: [header()], sequences: [sequence()]}
@doc """
Read a FASTA formatted file
The `read/2` function returns an error tuple of the content or error code from
`File.read`. You can use `:file.format_error/1` to get a descriptive string of
the error.
You can specify the return type of the contents by using a module which
implements the `Bio.Sequential` or equivalent behaviour. Specifically the type
must have a `new/2` function for building the struct.
The default option for the reader is a special module `Bio.IO.SequenceTuple`, which
will return the label and sequence as a tuple of raw binary. See
`Bio.IO.SequenceTuple.new/2` for details.
## Options
- `:type` - The module for the type of struct you wish to have returned. This
should minimally implement a `new/2` function equivalent to the
`Bio.Sequential` behaviour. Otherwise the base `Bio.IO.SequenceTuple` is used.
- `:parse_header` - A callable for parsing the header values of the FASTA
file. Otherwise identity is used and the header is returned as is.
## Examples
iex>Bio.IO.Fasta.read("test/fasta/test_1.fasta")
{:ok, [{"header1", "ataatatgatagtagatagatagtcctatga"}]}
"""
@spec read(filename :: Path.t(), opts :: [read_opts]) :: {:ok, any()} | {:error, File.posix()}
def read(filename, opts \\ []) do
type = Keyword.get(opts, :type, Bio.IO.SequenceTuple)
h_fn = Keyword.get(opts, :parse_header, & &1)
case File.read(filename) do
{:ok, content} ->
{:ok, parse(content, "", [], :header, type, h_fn)}
not_ok ->
not_ok
end
end
@doc """
Produces the same output as `read!/2`, but presumes that the file contents are
loaded into a binary.
"""
def from_binary(contents, opts \\ []) do
type = Keyword.get(opts, :type, Bio.IO.SequenceTuple)
h_fn = Keyword.get(opts, :parse_header, & &1)
{:ok, parse(contents, "", [], :header, type, h_fn)}
end
@doc """
Read a FASTA formatted file
The same as `read/2`, but will raise a `File.Error` on failure.
"""
@spec read!(filename :: Path.t(), opts :: [read_opts]) :: any() | no_return()
def read!(filename, opts \\ []) do
type = Keyword.get(opts, :type, Bio.IO.SequenceTuple)
h_fn = Keyword.get(opts, :parse_header, & &1)
parse(File.read!(filename), "", [], :header, type, h_fn)
end
@doc """
Write a FASTA file using sequence data.
The data type that this function accepts is varied, and may be one of a number
of `List`s. Examples of which types are handled:
List:
``` elixir
# a list of header/sequence tuples
[{header(), sequence()}, ...]
# a list of header/sequence implicitly paired
[header(), sequence(), header(), sequence(), ...]
# a list of struct()
[%Bio.Sequence._{}, ...]
```
Where `%Bio.Sequence._{}` indicates any struct of the `Bio.Sequence` module or
modules implementing the `Bio.Sequential` behaviour.
It also supports data in a `Map` format:
``` elixir
%{
headers: [header(), ...],
sequences: [sequence(), ...]
}
```
## Examples
iex> Fasta.write("/tmp/test_file.fasta", ["header", "sequence", "header2", "sequence2"])
:ok
Will return error types in common with `File.write/3`
"""
@spec write(filename :: Path.t(), data :: fasta_data, [File.mode()]) ::
:ok | {:error, File.posix()}
def write(filename, data, modes \\ [])
def write(filename, {header, sequence}, modes) do
File.write(filename, ">#{header}\n#{sequence}\n", modes)
end
def write(filename, [header, sequence], modes) do
File.write(filename, ">#{header}\n#{sequence}\n", modes)
end
def write(filename, data, modes) when is_list(data) do
[datum | _] = data
data =
if is_binary(datum) do
data |> Enum.chunk_every(2)
else
data
end
data
|> Enum.reduce("", &to_line/2)
|> then(fn output -> File.write(filename, output, modes) end)
end
def write(filename, %{headers: headers, sequences: sequences}, modes) do
Enum.zip(headers, sequences)
|> Enum.reduce("", &to_line/2)
|> then(fn output -> File.write(filename, output, modes) end)
end
defp parse(content, value, acc, _ctx, type, header_fn) when content == "" do
# this will be [seq, header] for all the parsed seqs
[value | acc]
|> Enum.chunk_every(2)
|> Enum.reduce([], fn [seq, header], acc ->
List.insert_at(acc, 0, apply(type, :new, [seq, [label: header_fn.(header)]]))
end)
end
defp parse(content, value, acc, ctx, type, header_fn) when ctx == :header do
<<char::binary-size(1), rest::binary>> = content
case char do
">" -> parse(rest, value, acc, :header, type, header_fn)
c when c in ["\n", "\r"] -> parse(rest, "", [value | acc], :sequence, type, header_fn)
_ -> parse(rest, value <> char, acc, :header, type, header_fn)
end
end
defp parse(content, value, acc, ctx, type, header_fn) when ctx == :sequence do
<<char::binary-size(1), rest::binary>> = content
case char do
">" -> parse(rest, "", [value | acc], :header, type, header_fn)
c when c in ["\n", "\r"] -> parse(rest, value, acc, :sequence, type, header_fn)
_ -> parse(rest, value <> char, acc, :sequence, type, header_fn)
end
end
defp to_line([header, sequence], acc) do
acc <> ">#{header}\n#{sequence}\n"
end
defp to_line({header, sequence}, acc) do
acc <> ">#{header}\n#{sequence}\n"
end
defp to_line(%_{} = datum, acc) do
acc <> apply(datum.__struct__, :fasta_line, [datum])
end
end